Cool Viro Stuff

Posted in DNA Viruses, Virology Fun on May 9, 2009 by virelegy

http://news.bbc.co.uk/1/hi/technology/7977585.stm

Debate in science…

Posted in Debate on May 8, 2009 by virelegy

posted by Kendra

From the Racaniello blog, post May 6th: http://www.virology.ws/2009/05/06/release-of-influenza-viral-rnas-into-cells/

The diagram shows amantadine in the M2 channel contrary to suggestions of an allosteric binding site as discussed in BCMP201.

Any thoughts on this in particular or on the existence of “camps” supporting different models in science? Is this sort of division good or bad?

The Virelegy

Posted in Virology Fun on May 8, 2009 by virelegy

by Kevin, Laura, and Jeff

Translation:

As darkness crept across the land,

and disease stretched out its dismal hand.

As hope had waned ever so bleak,

a summon for heroes, did sage Knipe speak.

For pestilence dim was set in motion,

and could only be slain by scholars’ devotion.

And so they came, twelve heroes in all,

and by their toil, many plagues would hopefully fall.

One from a valley where three rivers combine.

Another from the north across nations’ divide.

One from the lands of Alarik’s heir.

One from the Thames’ lands fair.

Three from a land betwixt two gulfs, a strait, and a sea.

From Hudson’s empire came another three.

One from where the college of King’s was born.

And two from where Hudson met his crew’s scorn.

Then came two maidens separated by a great sea,

One from where the greatest empire came to be.

The last from the state of Lyme,

Where another great plague had seen its prime.

They assembled on the Longwood Quad,

Hoping not to be banished to the repechage.

Only sage Knipe is able to see.

Just how long their toils will be.

For the virus is an awesome foe

Against which mankind has little to show

For how much time must mankind give

To finally kill that which does not live

And so the Vir-Elegy has been set in motion

Only to be conquered by the twelve’s devotion.

Transcript:

ggatccggcg acactccacc atgaatcact cccctgtgag gaactactgt cttcacgcagaaagcgtcta gccatggcgt tagtatgagt gtcgtgcagc ctccaggacc ccccctcccgggagcgccat agtggtctgc ggaaccggtg agtacaccgg aattgccagg acgaccgggtcctttcttga taaacccgct caatgcctgg agatttgggc gtgcccccgc aagactgctagccgagtagt gttgggtcgc gaaaggcctt gtggtactgc ctgatagggt gcttgcgantgccccgggag gtctcgtana ccgtgcacca tgagcacgaa tctggatcc

AUGGCCagc gacgccaggaagaacgagagcagc ugcagggagcccacc gccugcaggOagcagc acccacgag cuggccaacgac,

gccaacgac gacaucagcgaggccagcgag agcaccagggagaccugccacgaggac OUacc aucaccagc gacaucagcauggcccugcacgccaacgacuga

AUGGCCagccacOcccgagcacgccgac ugggccaacgaggac gagguggagagg agcO Bcuggaggccaag,

gcc agcUaugaugOaac uucOaggcacgagaggOgagagc, gacaucgac agcgccggcgag AAGaacauccccgag agccccgaggccaaguga

AUGUUCOagg cccgagagcaccauccuggagaacugcgag gacaucaug ugggccagc agcgagacc aucaac augOaccaucOaac,

gccaacgac ugcOUcuggac Oaaccuguac Bgag agccuggccaucaac Buac agcugccacOcuggccaggagc’ gacgaggugOaccaucOaacuga

AUGGCCaacgac agcO acccacgaguac ugcgccauggag, accugggagcugguggagcacgagaggOgagagc aucaac gcccugcug, gccaacgac Buac acccacgagaucagg accOauccug,

auggccaacuac ccccuggccggcUgagagc uggOUcuggaccacOcccgaguucUcugcuguac uucgcccugcuguga

AUGOaacgag uucaggOaug gcc guggcccugcuggaguac uggcacgagagggag acccacagggaggag aggaucguggagaggagc ugcOaugBaucaacgaguga

AUGGCCaacOacccacgagagg uucaggOaug acccacgag aacOaggacccac gccugcaggOagcagc aacgccaccaucOaacagc’ gacaucgugaucgacgaguga

AUGOaacgag uucaggOaug acccacgag cuggccaacgacagc Ouuc GCCcuggccaggaucaag’agccacgagaucagguga

AUGOaacgag uucaggOaug acccacgag ACCcacgccauggagagc’ cuggccaacgacagc uucgccaucagguga

AUGACCcacagggaggag uucaggOaug gcc cuggccaacgac BgagaccuggaucXacc accuggO ggcUcuguucagc, gcc agcaccagggccaucacc, gccaacgac gcc agcgaggccuga

AUGUUCaggOaug CACUgacagcOaac’agc gagaugcccaucagggag ugcgccauggag gccaacOacccacgagagg acccacagggaggaguga

AUGOaacgag uucaggOaug uggcacgagagggag acccacgag ugcOcugcuggagggcgag Ouuc AAGaucaacggc’agc ugggccagc BOaggaacuga

AUGGCCaacgac accuggO uucaggOaug UGGcacgagagggagcacUgacagcOaac auggagacccacaucagc ugcagggagugg’agc agcugcOaggaacuga

ACCcacgagaac ugcgccauggag accuggO auggccaucGACgagaacagc agcgagcccgccagggccaccgaggac Buac gcc ggcagggaggccacc agcgaggcc,

Oaacgag uucaggOaug uggcacgagagggag acccacgag ggcagggaggccaccgagagcacc gagaugcccaucagggag ugcgccauggag accO Bgaguga

ACCcacgag cuggccagcacc uucaggOaug acccacgag agcaccgccaccgag Ouuc CUGuacauggag,

uggcacgagagggag gccaacOacccacgagagg ggcagggaggccacc ccccuggccggcUgagcacgccgac agcgaggagaac aucaccagc cccaggaucauggaguga

AUGACCcacgaguac gccagcagcgagaugBcuggaggac Oaac acccacgag CUGOaacggcuggOOgac CAGUgccgac,

cacOcccaucaacggc aacOacc accO Bgag Bgccaacaucagccacgaggac accO acccacgag agggagcccgagugccacgccggcgaguga

AUGOaaccuguac agcgccggcgag AAGaacauccccgag aucagc gccBcuggag accO agcgaggaguga

AUGJUagcacc cacOugg cugOaacggc acccacgagaucagg accOauccugagc uggauccugcug Bgaguga

AUGUUCOagg acccacgag gugaucaggUagc aucagc gccaac gccugggagagcOauggag uucOgag,

gccggcgccaucaacagcacc uggcacaucugccac auggccaacaagaucaacgaccacgccagc cugaucaccacccuggag accO agccacOugguga

AUGUUCOaggcacOugg augUugccac accaucauggag augUagcacc auggccaacaagaucaacgac ggcaucguggag,

accO uucaucaacgcccugcuguac aagauccugcug acccacgccacc uggcacaucugccac gacOgagagc aacOacc cugaucguggaguga

AUGGCCaacgac agcO acccacgag GUGaucagg-GAGcuggagggcuac cacgccagc Bgaggagaac agcgagacc aucaac augOaccaucOaac,

Oaaccuguac accO Bgag ugcOaaccagUgagagggaggac Buac acccacgag accugggagcugguggag’agc gacgaggugOaccaucOaacuga aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa